Sequence ID | >WENV182786038 |
Genome ID | OJSI01001989 |
Search identical group | |
Phylum/Class | [OJSI] human gut metagenome; human gut |
Species | |
Start position on genome | 783 |
End posion on genome | 692 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tgtaagccat |
tRNA gene sequence |
GGAGAGCTGTCCGAGTGGCTGAAGGAGCATGATTGGAAATCATGTATAGGGCGAACGCTC |
Downstream region at tRNA end position |
gaatgtaaaa |
Secondary structure (Cloverleaf model) | >WENV182786038 Ser GGA t GCCA gaatgtaaaa G - C G - C A - T G - C A - T G - C C - G T A T C A C C C A T G A G | | | | | A G G C C T G T G G G C G | | | T T C A G G A T G A G TATAGGGCGAACGCTCTATC C - G A - T T - A G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |