Sequence ID | >WENV182790322 |
Genome ID | OJSM01008632 |
Search identical group | |
Phylum/Class | [OJSM] human gut metagenome; human gut |
Species | |
Start position on genome | 2171 |
End posion on genome | 2256 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
taggcgcaaa |
tRNA gene sequence |
GGGTAGATGTCTGAGCGGTCTAAAGAGACGGTCTTGAAAACCGTTGAGGTGCAAGCCTCC |
Downstream region at tRNA end position |
cgaaggtccg |
Secondary structure (Cloverleaf model) | >WENV182790322 Ser TGA a GCag cgaaggtccg G - C G - C G - C T + G A - T G - C A - T T A T C G C T C A C G A G | | | | | G G G T C T G C G A G C G | | | T T T A A G A C T A G TGAGGTGCAAGCCTCC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |