Sequence ID | >W141277307 |
Genome ID | JAEM01000012 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Paracoccus pantotrophus J46 [JAEM] |
Start position on genome | 23711 |
End posion on genome | 23787 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gcgacaggtc |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCGACGGTTTTGGGTACCGTAGGCCGGAGGTTCGAA |
Downstream region at tRNA end position |
ccactcagtc |
Secondary structure (Cloverleaf model) | >W141277307 Pro TGG c ACCA ccactcagtc C - G G - C G - C G - C G - C C - G G - C T A T T C T C C A C G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A G AGGCC A - T C - G G - C G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |