Sequence ID | >W141278221 |
Genome ID | JAFE01000003 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfonatronum lacustre DSM 10312 [JAFE] |
Start position on genome | 287513 |
End posion on genome | 287439 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
attgatcaat |
tRNA gene sequence |
TGGGGTGTCGCCAAGCGGTAAGGCACGGGTCTTTGGAATCCGCACTCGGAGGTTCGAATC |
Downstream region at tRNA end position |
tttaattcaa |
Secondary structure (Cloverleaf model) | >W141278221 Gln TTG t GCCA tttaattcaa T - A G - C G - C G - C G - C T - A G - C T A T C C T C C A G A C | | | | | G C A C C G G G A G G C G | | | T T G A G G C T A A CACTC C - G G - C G - C G + T T - A C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |