| Sequence ID | >W141278972 |
| Genome ID | JAFY01000007 |
| Phylum/Class | Synergistota |
| Species | Aminiphilus circumscriptus DSM 16581 [JAFY] |
| Start position on genome | 1018566 |
| End posion on genome | 1018490 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
tttgagtgga |
| tRNA gene sequence |
GGGCCGGTAGCTCAGGTGGCTAGAGCACACGGCTGATAACCGTGAGGTCAGTGGTTCGAA |
| Downstream region at tRNA end position |
gatttggttg |
| Secondary structure (Cloverleaf model) | >W141278972 Ile GAT
a ACCA gatttggttg
G - C
G - C
G - C
C - G
C - G
G - C
G - C T A
T T C A C C A
G G A A | | | | | G
T C T C G A G T G G C
G | | | | T T
G G A G C
C T A A AGGTC
C - G
A - T
C - G
G - C
G - C
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |