Sequence ID | >WENV182813908 |
Genome ID | OJYG01000952 |
Search identical group | |
Phylum/Class | [OJYG] human gut metagenome; human gut |
Species | |
Start position on genome | 4094 |
End posion on genome | 4167 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ttgaagccac |
tRNA gene sequence |
GCCACCTTAGCTCAGTGGTAGAGCATCCCCCTCGTTCGCGGGAAGGTCGGTAGTTCGATT |
Downstream region at tRNA end position |
gttcatcaag |
Secondary structure (Cloverleaf model) | >WENV182813908 Thr CGT c TCtt gttcatcaag G - C C - G C - G A - T C - G C - G T + G T T T C T A T C A G A A | + | | | G T C T C G G G T A G C G | | | | T T G G A G C T A A AAGGTC T + G C - G C - G C C C - G C C T T C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |