Sequence ID | >WENV182815933 |
Genome ID | OJYV01000037 |
Search identical group | |
Phylum/Class | [OJYV] human gut metagenome; human gut |
Species | |
Start position on genome | 1181 |
End posion on genome | 1258 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tggacgcgaT |
tRNA gene sequence |
GGCCGGGTAGCTCAGTTGGTAGCAGCGTTCGCCTGAAAAGTGAAAGGTCACCGGTTCGAC |
Downstream region at tRNA end position |
caaagaacgt |
Secondary structure (Cloverleaf model) | >WENV182815933 Phe GAA T ACCC caaagaacgt G - C G - C C - G C - G G - C G - C G - C C C T T G G C C A T G A A | | | | | G T C T C G A C C G G C G | | | T T G C A G C T A G G AGGTC T - A T - A C - G G + T C - G C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |