Sequence ID | >WENV182835845 |
Genome ID | OKFR01001891 |
Search identical group | |
Phylum/Class | [OKFR] human gut metagenome; human gut |
Species | |
Start position on genome | 87 |
End posion on genome | 160 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaggcaacgg |
tRNA gene sequence |
GCCCCCATCGTCTAGCGGCCTAGGACACCGCCCTTTCACGGCGGCGGCACGGGTTCGAAT |
Downstream region at tRNA end position |
agctctttcg |
Secondary structure (Cloverleaf model) | >WENV182835845 Glu TTC g ACga agctctttcg G + T C - G C - G C - G C - G C - G A - T T A T T G C C C A C G A C | | | | | G G T C T G A C G G G C G + | | | T T C G G A C C T A A CGGC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |