Sequence ID | >WENV182836133 |
Genome ID | OKFV01000042 |
Search identical group | |
Phylum/Class | [OKFV] human gut metagenome; human gut |
Species | |
Start position on genome | 30672 |
End posion on genome | 30746 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggggctctct |
tRNA gene sequence |
GGCGGGGTAGCTCAGCTGGCTAGAGCGTACGACTCATAATCGTAAGGTCAAGAGTTCGAG |
Downstream region at tRNA end position |
atcgcgcccg |
Secondary structure (Cloverleaf model) | >WENV182836133 Met CAT t ACaa atcgcgcccg G + T G - C C - G G - C G + T G - C G - C C G T T T C T C A C G A A | | | | | G T C T C G A A G A G C G | | | | T T G G A G C C T A G AGGTC T - A A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |