Sequence ID | >WENV182842064 |
Genome ID | OKIB01000290 |
Search identical group | |
Phylum/Class | [OKIB] human gut metagenome; human gut |
Species | |
Start position on genome | 20884 |
End posion on genome | 20960 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctccatacat |
tRNA gene sequence |
GGCGGCATAGCTCAGTTGGCTAGAGCAATCGGTTCATACCCGGTGTGTCCGCGGTTCAAA |
Downstream region at tRNA end position |
ttaaacctca |
Secondary structure (Cloverleaf model) | >WENV182842064 Met CAT t ACCA ttaaacctca G - C G - C C - G G - C G - C C - G A - T T A T G T G C C A T G A A | + | | | A T C T C G C G C G G C G | | | | T T G G A G C C T A A GTGTC A - T T + G C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |