Sequence ID | >C08010918 |
Genome ID | CP000969 |
Search identical group | |
Phylum/Class | Thermotogota |
Species | Thermotoga sp. RQ2 [CP000969] |
Start position on genome | 479467 |
End posion on genome | 479395 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aacggtcttg |
tRNA gene sequence |
GGCGGCGTAGCTCAGCGGCGAGAGCGGGTGATTCATAATCACCGTGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
gtcatcggaa |
Secondary structure (Cloverleaf model) | >C08010918 Met CAT g Atag gtcatcggaa G - C G - C C - G G - C G - C C - G G - C T G T C A C C C A C G A A | | | | | G G C T C G G T G G G C G | | | | T T C G A G C G A G GTGTC G - C G - C T - A G - C A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |