Sequence ID | >WENV182852552 |
Genome ID | OKLZ01000005 |
Search identical group | |
Phylum/Class | [OKLZ] human gut metagenome; human gut |
Species | |
Start position on genome | 124629 |
End posion on genome | 124705 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cgcaccatat |
tRNA gene sequence |
GCGTCCGTAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
tttcaatcat |
Secondary structure (Cloverleaf model) | >WENV182852552 Val GAC t ACCA tttcaatcat G - C C - G G - C T - A C - G C - G G - C T G T T C A C C A T G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |