Sequence ID | >WENV182863004 |
Genome ID | OKPQ01000296 |
Search identical group | |
Phylum/Class | [OKPQ] human gut metagenome; human gut |
Species | |
Start position on genome | 486 |
End posion on genome | 403 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gttccgatac |
tRNA gene sequence |
GCCGGAGTGGCGGAATGGCAGACGCACTTGACTCAAAATCAAGCGGGTAACACCGTGTGG |
Downstream region at tRNA end position |
actacaagcg |
Secondary structure (Cloverleaf model) | >WENV182863004 Leu CAA c ACCA actacaagcg G - C C - G C - G G - C G - C A - T G - C T G T C A C C C A T A A G | | | | | A G G G C G G T G G G C G | | | T T C A C G C A G A CGGGTAACACCGT C - G T - A T - A G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |