Sequence ID | >WENV182864716 |
Genome ID | OKQE01000377 |
Search identical group | |
Phylum/Class | [OKQE] human gut metagenome; human gut |
Species | |
Start position on genome | 11528 |
End posion on genome | 11602 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
taatcactgt |
tRNA gene sequence |
AGGGGTGTCGCCAAGTGGTAAGGCAACGGACTTTGACTCCGTTATGCGCTGGTTCGATCC |
Downstream region at tRNA end position |
acatgactca |
Secondary structure (Cloverleaf model) | >WENV182864716 Gln TTG t GCCA acatgactca A - T G - C G - C G - C G - C T - A G - C C T T C G A C C A G A C | | | | | G T A C C G G C T G G C G | | | T T G A G G C T A A TATGC A - T C - G G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |