Sequence ID | >WENV182866931 |
Genome ID | OKRR01002462 |
Search identical group | |
Phylum/Class | [OKRR] human gut metagenome; faeces |
Species | |
Start position on genome | 2791 |
End posion on genome | 2716 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tgttgatatc |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGGGGACTCTTAATCCCAAGGTCCAGGGTTCGACC |
Downstream region at tRNA end position |
cacgatatct |
Secondary structure (Cloverleaf model) | >WENV182866931 Lys CTT c ACCA cacgatatct G - C G - C G - C T + G C - G G - C T - A C C T G T C C C A T G A A | | | | | G T C T C G C A G G G C G | | | | T T G G A G C T A A AGGTC G A G - C G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |