Sequence ID | >WENV182881617 |
Genome ID | OKSA01018648 |
Search identical group | |
Phylum/Class | [OKSA] human gut metagenome; faeces |
Species | |
Start position on genome | 428 |
End posion on genome | 352 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
cggaacgtat |
tRNA gene sequence |
GCGTTGGTAGCTCAGCTGGATAGAGTGACTGACTACGAATCAGTAGGCCGGGGGTTCGAG |
Downstream region at tRNA end position |
gaaaatgccg |
Secondary structure (Cloverleaf model) | >WENV182881617 Arg ACG t ACCA gaaaatgccg G - C C - G G - C T T T - A G - C G - C T G T T T C C C A C G A A + + | | | G T C T C G G G G G G C G | | | + T T G G A G T A T A G AGGCC A - T C - G T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |