Sequence ID | >WENV182899712 |
Genome ID | OKST01000757 |
Search identical group | |
Phylum/Class | [OKST] human gut metagenome; feces |
Species | |
Start position on genome | 14641 |
End posion on genome | 14557 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tatgtgtaat |
tRNA gene sequence |
GCGGGGGTGGTCGAGTGGTCAAAGGCGATAGGTTGAGGGCCTATTGGGTTAGTCCCTTCG |
Downstream region at tRNA end position |
ttattgataa |
Secondary structure (Cloverleaf model) | >WENV182899712 Leu GAG t ACtt ttattgataa G - C C - G G - C G - C G - C G + T G - C T G T T G C C C A T G A G + | | | | A G G C T G G C G G G C G | + | T T T A G G C C A A G TGGGTTAGTCCCTTC A - T T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |