Sequence ID | >WENV182904398 |
Genome ID | OKTA01000184 |
Search identical group | |
Phylum/Class | [OKTA] human gut metagenome; feces |
Species | |
Start position on genome | 53468 |
End posion on genome | 53394 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
atcaacctaT |
tRNA gene sequence |
TCCTCGATAGCTCAGTCGGTAGAGCACGCGGCTGTTAACCGCGCTGTCGTAGGTTCAAGT |
Downstream region at tRNA end position |
tttaatttat |
Secondary structure (Cloverleaf model) | >WENV182904398 Asn GTT T GTtt tttaatttat T - A C - G C - G T + G C - G G - C A - T T G T C A T C C A T G A A | | | | | A C C T C G G T A G G C G | | | | T T G G A G C T A A CTGTC C - G G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |