Sequence ID | >WENV182906219 |
Genome ID | OKTD01000161 |
Search identical group | |
Phylum/Class | [OKTD] human gut metagenome; feces |
Species | |
Start position on genome | 47545 |
End posion on genome | 47472 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cttaatacat |
tRNA gene sequence |
GCGATAGTGGCGTAGTTGGTAACGCGCGACCTTGCCAAGGTCGAGACCGCGGGTTCGAGC |
Downstream region at tRNA end position |
ataacataaa |
Secondary structure (Cloverleaf model) | >WENV182906219 Gly GCC t TCtt ataacataaa G - C C - G G - C A - T T - A A - T G - C C G T T G C C C A T G A G + | | | | G T T G C G G C G G G C G | | | | T T G A C G C T A G AGACC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |