Sequence ID | >W141290135 |
Genome ID | JASC01000014 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sulfitobacter noctilucae NB-68 [JASC] |
Start position on genome | 1028024 |
End posion on genome | 1027951 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
caaaccttga |
tRNA gene sequence |
GCGGGTATGGTGAAAAGGTATCACGGCAGCTTCCCAAGCTTTAGTTACGAGTTCGATTCT |
Downstream region at tRNA end position |
gaaatcccaa |
Secondary structure (Cloverleaf model) | >W141290135 Gly CCC a TCCA gaaatcccaa G - C C - G G - C G - C G - C T - A A - T T T T T G C T C A A A G | | | | | G A A G T G A C G A G C G | | | | T T G T C A C T A G AGTT G + T C T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |