Sequence ID | >WENV182927404 |
Genome ID | OKUM01030207 |
Search identical group | |
Phylum/Class | [OKUM] human gut metagenome; feces |
Species | |
Start position on genome | 212 |
End posion on genome | 286 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttcaagacaT |
tRNA gene sequence |
GCCGACTTAGCTCAGCTGGCAGAGCATCTGATTTGTAATCAGAGGGTCGGAGGTTCGAAT |
Downstream region at tRNA end position |
gcggaagtag |
Secondary structure (Cloverleaf model) | >WENV182927404 Thr TGT T ATat gcggaagtag G - C C - G C - G G - C A - T C - G T - A T A T T C T C C A C G A A + | | | | G T C T C G G G A G G C G | | | | T T G G A G C C A A GGGTC T - A C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |