Sequence ID | >WENV182934503 |
Genome ID | OKUX01009164 |
Search identical group | |
Phylum/Class | [OKUX] human gut metagenome; feces |
Species | |
Start position on genome | 181 |
End posion on genome | 256 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aataaaataT |
tRNA gene sequence |
GTGTGTGTAGCTCAGCTGGATAGAGCACTTGGCTACGGACCAAGGTGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
aaaaaggact |
Secondary structure (Cloverleaf model) | >WENV182934503 Arg ACG T GTgg aaaaaggact G - C T - A G - C T + G G - C T - A G - C T A T T C T T C A C G A A + | + | | G T C T C G G G G A G C G | | | | T T G G A G C A T A A GTGTC C - G T - A T - A G - C G - C C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |