Sequence ID | >WENV182958398 |
Genome ID | OKWH01008829 |
Search identical group | |
Phylum/Class | [OKWH] human gut metagenome; human gut |
Species | |
Start position on genome | 225 |
End posion on genome | 299 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
catatggtaa |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCTGGAAGCTCGTCGGGCTCATAACCCGAAGGTCATAGGTTCAAA |
Downstream region at tRNA end position |
aatgcccaga |
Secondary structure (Cloverleaf model) | >WENV182958398 fMet CAT a ACtc aatgcccaga C T G - C C - G G - C G - C G - C G - C T A T T G T C C A T G A G | + | | | A C C G A G A T A G G C T | | | | T T G G C T C G A A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |