Sequence ID | >WENV182961144 |
Genome ID | OKWK01000215 |
Search identical group | |
Phylum/Class | [OKWK] human gut metagenome; stool |
Species | |
Start position on genome | 18395 |
End posion on genome | 18320 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaacaccatg |
tRNA gene sequence |
GTGGCCATAGCTCAGTTGGTAGAGCATCTGATTGTGGTTCAGAAGGTCGCGCGTTCGAGC |
Downstream region at tRNA end position |
gcaagaccct |
Secondary structure (Cloverleaf model) | >WENV182961144 His GTG g CCCA gcaagaccct G - C T - A G - C G - C C - G C - G A - T C G T T G C G C A T G A A + | | | | G T C T C G G C G C G C G | | | | T T G G A G C T A A AGGTC T - A C - G T - A G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |