Sequence ID | >WENV182965634 |
Genome ID | OKWT01000013 |
Search identical group | |
Phylum/Class | [OKWT] human gut metagenome; stool |
Species | |
Start position on genome | 89846 |
End posion on genome | 89771 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aaaaaatcat |
tRNA gene sequence |
GCCTCGGTAGCTCAGTTGGTAGAGCAACGGACTGAAAATCCGTGTGTCGACAGTTCGATT |
Downstream region at tRNA end position |
tttgtattcc |
Secondary structure (Cloverleaf model) | >WENV182965634 Phe GAA t ACCA tttgtattcc G - C C - G C - G T - A C - G G + T G - C T T T C T G T C A T G A A | | | | | G T C T C G G A C A G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |