Sequence ID | >WENV182982248 |
Genome ID | OKZC01000006 |
Search identical group | |
Phylum/Class | [OKZC] human gut metagenome; human gut |
Species | |
Start position on genome | 6715 |
End posion on genome | 6643 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gatgtccgtt |
tRNA gene sequence |
GGTCGATTCATCTAATGGTTAGGATACAAGATTCTCAATCTTGGCATAGGGGTTCGATTC |
Downstream region at tRNA end position |
tatggtttaa |
Secondary structure (Cloverleaf model) | >WENV182982248 Glu CTC t ACtt tatggtttaa G + T G - C T - A C - G G - C A - T T - A T T T T C C C C A T A A C | | | | | G G T C T A A G G G G C G + | | | T T T G G A T T A A GCAT C - G A - T A - T G - C A - T T A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |