Sequence ID | >WENV182983461 |
Genome ID | OKZG01001867 |
Search identical group | |
Phylum/Class | [OKZG] human gut metagenome; human gut |
Species | |
Start position on genome | 947 |
End posion on genome | 1022 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
atccgcaatt |
tRNA gene sequence |
CGGGGTGTAGCTCAGCCCGGTTAGAGTACGCGTCTGGGGGGCGTGTGGTCGCTGGTTCGA |
Downstream region at tRNA end position |
accacaaagc |
Secondary structure (Cloverleaf model) | >WENV182983461 Pro GGG t ACta accacaaagc C - G G - C G - C G - C G - C T - A G - C T A T T G A C C A C C G A A + | | | | G C C T C G G C T G G C G | | | + T T G G A G T T T A A TGGTC C - G G + T C - G G - C T + G C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |