Sequence ID | >WENV182985806 |
Genome ID | OKZR01003183 |
Search identical group | |
Phylum/Class | [OKZR] human gut metagenome; human gut |
Species | |
Start position on genome | 762 |
End posion on genome | 689 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tgtacatcat |
tRNA gene sequence |
GCGGGCGTAGTTCATCGGTAGAATGCGAGCTTCCCAAGCTTGAGAGGAGGGTTCGATTCC |
Downstream region at tRNA end position |
tacataatat |
Secondary structure (Cloverleaf model) | >WENV182985806 Gly CCC t TCCA tacataatat G - C C - G G - C G - C G - C C - G G - C T T T T T C C C A T A A + | | | | G C C T T G G A G G G C G | | | + T T G G A A T T A G AGAG C - G G + T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |