Sequence ID | >WENV183010267 |
Genome ID | OLDU01004581 |
Search identical group | |
Phylum/Class | [OLDU] human gut metagenome; human gut |
Species | |
Start position on genome | 370 |
End posion on genome | 444 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
aactaactga |
tRNA gene sequence |
GGGCCTATAGCTCAGGGGTAGAGCAACCGGCTCATAACCGGTCGGTCCCTGGTTCGAACC |
Downstream region at tRNA end position |
ttatgttgat |
Secondary structure (Cloverleaf model) | >WENV183010267 Ile2 CAT a ACCA ttatgttgat G - C G - C G - C C - G C - G T + G A - T C A T G G A C C A G A A | | | | | G G C T C G C C T G G C G | | | | T T G G A G C T A A CGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |