Sequence ID | >WENV183022611 |
Genome ID | OLFR01000774 |
Search identical group | |
Phylum/Class | [OLFR] human gut metagenome; human gut |
Species | |
Start position on genome | 6251 |
End posion on genome | 6323 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gtattcccgc |
tRNA gene sequence |
CGGGGTGTTGCGCAGTTGGTAGCGCGCCTGCTTTGGGAGCAGGAGGCCGCGAGTTCGAGT |
Downstream region at tRNA end position |
agaaacgtga |
Secondary structure (Cloverleaf model) | >WENV183022611 Pro TGG c Ataa agaaacgtga C - G G - C G - C G + T G - C T - A G - C T G T C G C T C A T G A T | | | | | G T C G C G G C G A G C G | | | | T T G G C G C T A G AGGCC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |