Sequence ID | >C08004677 |
Genome ID | CP001055 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobium minutum Pei191 [CP001055] |
Start position on genome | 452102 |
End posion on genome | 452030 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttatttgtac |
tRNA gene sequence |
GCCGAGGTAGCTCAGCTGGTAGAGCAACGGTTTTGTAAACCGTAGGTCGTGGGTTCGATC |
Downstream region at tRNA end position |
ttttgcccta |
Secondary structure (Cloverleaf model) | >C08004677 Thr TGT c Tttt ttttgcccta G - C C - G C - G G - C A - T G - C G - C C T T T A C C C A C G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A AGGTC A - T C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |