Sequence ID | >WENV183029041 |
Genome ID | OLFV01030830 |
Search identical group | |
Phylum/Class | [OLFV] human gut metagenome; faeces |
Species | |
Start position on genome | 387 |
End posion on genome | 480 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
cgaactttag |
tRNA gene sequence |
GGAAACGTTTCGTCACCGGTGTGGCGCCCAGTCTTCAAAACTGGTGGACGGTCGAAAGGT |
Downstream region at tRNA end position |
aaaagaatcc |
Secondary structure (Cloverleaf model) | >WENV183029041 SeC TCA g GCCA aaaagaatcc G - C G - C A - T A - T A - T C - G G - C T - A T C T T A T C C A C C A T + | | | | G G C T G C G T A G G C G | + | | T T T G G C G G T C TGGACGGTCGAAAGGTCGTTG C - G C - G A - T G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |