Sequence ID | >WENV183038420 |
Genome ID | OLGB01000489 |
Search identical group | |
Phylum/Class | [OLGB] human gut metagenome; faeces |
Species | |
Start position on genome | 47733 |
End posion on genome | 47658 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
atccgcaatt |
tRNA gene sequence |
CGGGGTGTAGCTCAGCCCGGTTAGAGTACGCGTCTGGGGGGCGTGTGGTCGCTGGTTCGA |
Downstream region at tRNA end position |
gtagaaaagg |
Secondary structure (Cloverleaf model) | >WENV183038420 Pro GGG t ACtg gtagaaaagg C - G G - C G - C G - C G - C T - A G - C T A T T G A C C A C C G A A + | | | | G C C T C G G C T G G C G | | | + T T G G A G T T T A A TGGTC C - G G + T C - G G - C T + G C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |