Sequence ID | >WENV183039693 |
Genome ID | OLGB01012493 |
Search identical group | |
Phylum/Class | [OLGB] human gut metagenome; faeces |
Species | |
Start position on genome | 204 |
End posion on genome | 279 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccattttgac |
tRNA gene sequence |
GGTCCCATCGTCTAGAGGTCTAGGACATCGCCCTTTCACGGCGACGGCAGGGGTTCGAAT |
Downstream region at tRNA end position |
tttttcaaac |
Secondary structure (Cloverleaf model) | >WENV183039693 Glu TTC c GCCA tttttcaaac G + T G - C T - A C - G C - G C - G A - T T A T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C C T A A CGGC T - A C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |