Sequence ID | >WENV183055005 |
Genome ID | OLGW01000584 |
Search identical group | |
Phylum/Class | [OLGW] seawater metagenome; Sea water |
Species | |
Start position on genome | 2449 |
End posion on genome | 2378 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
agttccctgc |
tRNA gene sequence |
GGGGATGTAGCTCAATGGTAGAGCCTCAGTTTTCCAAACTGATGGCGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ttgcgagttg |
Secondary structure (Cloverleaf model) | >WENV183055005 Gly TCC c TCtt ttgcgagttg G - C G - C G - C G - C A - T T - A G - C T T T T G C C C A A A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A C TGGC T - A C - G A - T G - C T - A T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |