Sequence ID | >WENV183055483 |
Genome ID | OLHD01000014 |
Search identical group | |
Phylum/Class | [OLHD] seawater metagenome; Sea water |
Species | |
Start position on genome | 90385 |
End posion on genome | 90460 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tgttctatgt |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCTTCGCTGGCAGCGAAGAGGTCTGCGGTTCGATC |
Downstream region at tRNA end position |
atattattta |
Secondary structure (Cloverleaf model) | >WENV183055483 Ala GGC t ACCA atattattta G - C G - C G + T G - C C - G T - A A - T C T T A C G C C A C G A A | | | | | G T C T C G T G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |