Sequence ID | >WENV183056678 |
Genome ID | OLHJ01004305 |
Search identical group | |
Phylum/Class | [OLHJ] seawater metagenome; Sea water |
Species | |
Start position on genome | 179 |
End posion on genome | 253 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
gggaatacaa |
tRNA gene sequence |
GGCTGCGTAGTTCAACTGGATAGAATATCAGATTTCGGCTCTGAGGGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
gagcggacaa |
Secondary structure (Cloverleaf model) | >WENV183056678 Arg TCG a ACaa gagcggacaa G - C G + T C - G T + G G - C C - G G - C T A T T T C C C A C A A A + + | | | G T C T T G G G G G G C G | | | + T T G G A A T A T A A GGGTT T - A C - G A - T G - C A - T T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |