Sequence ID | >WENV183057477 |
Genome ID | OLHL01003264 |
Search identical group | |
Phylum/Class | [OLHL] seawater metagenome; Sea water |
Species | |
Start position on genome | 1796 |
End posion on genome | 1720 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
atataaagtt |
tRNA gene sequence |
GGCCCCTTAGCTCAGTTGGTTAGAGCACACGACTCATAATCGTTAGGTCCCCAGTTCGAG |
Downstream region at tRNA end position |
cttttcaaat |
Secondary structure (Cloverleaf model) | >WENV183057477 Ile2 CAT t ACCA cttttcaaat G - C G - C C - G C - G C - G C - G T - A T G T G G G T C A T G A A | | | | | G T C T C G C C C A G C G | | | | T T G G A G C T T A A AGGTC C T A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |