Sequence ID | >WENV183058064 |
Genome ID | OLHN01001967 |
Search identical group | |
Phylum/Class | [OLHN] seawater metagenome; Sea water |
Species | |
Start position on genome | 1601 |
End posion on genome | 1687 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acctatccaa |
tRNA gene sequence |
GCCAGTGTGATGGAATTGGTAGACATGACGGATTCAAAATCCGTTGCCAGCAATGGCGTG |
Downstream region at tRNA end position |
tattcttctt |
Secondary structure (Cloverleaf model) | >WENV183058064 Leu CAA a ACCA tattcttctt G + T C - G C - G A - T G - C T - A G - C T G T C C G C C A T A A G | | | | | A T G G T A G G C G G C G | | | T T G A C A T T A G G TGCCAGCAATGGCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |