Sequence ID | >WENV183060316 |
Genome ID | OLHX01002241 |
Search identical group | |
Phylum/Class | [OLHX] seawater metagenome; Sea water |
Species | |
Start position on genome | 778 |
End posion on genome | 851 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
attacgagat |
tRNA gene sequence |
TGGCCCATGGTGTAATTGGCAACACGTTGGTTTTTGGTACCGAAGAGTCTAGGTTCGAGC |
Downstream region at tRNA end position |
aacaagtata |
Secondary structure (Cloverleaf model) | >WENV183060316 Gln TTG t ACta aacaagtata T - A G - C G - C C - G C - G C - G A - T C G T G A T C C A T A A G | | | | | G T T G T G C T A G G C G | | | | T T G A C A C C A G AGAGT T - A T + G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |