Sequence ID | >WENV183060382 |
Genome ID | OLHX01006829 |
Search identical group | |
Phylum/Class | [OLHX] seawater metagenome; Sea water |
Species | |
Start position on genome | 392 |
End posion on genome | 465 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
accacgctac |
tRNA gene sequence |
GGGCTATTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCTCAGGTTCAAG |
Downstream region at tRNA end position |
cacgggggta |
Secondary structure (Cloverleaf model) | >WENV183060382 Ile GAT c Atgg cacgggggta G - C G - C G - C C - G T - A A - T T - A T G T A G T C C A G G A A | | | | | A T C T C G T C A G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |