Sequence ID | >WENV183079611 |
Genome ID | OLIX01045051 |
Search identical group | |
Phylum/Class | [OLIX] human gut metagenome; feces |
Species | |
Start position on genome | 144 |
End posion on genome | 218 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
actcatcagt |
tRNA gene sequence |
GCGGGAATAACTCAACGGTAGAGTGTCAGCTTCCCAAGCTGAAGGTTGCGGGTTCAAATC |
Downstream region at tRNA end position |
aaagcaataa |
Secondary structure (Cloverleaf model) | >WENV183079611 Gly CCC t TCCA aaagcaataa G - C C - G G - C G - C G - C A - T A - T T A T T G C C C A A A A + | | | | A C C T C A G C G G G C G | | | | T T G G A G T T A G AGGTT T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |