Sequence ID | >WENV183081535 |
Genome ID | OLJA01002322 |
Search identical group | |
Phylum/Class | [OLJA] human gut metagenome; human gut |
Species | |
Start position on genome | 741 |
End posion on genome | 815 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ccatgtacat |
tRNA gene sequence |
GCGGGAATAGCTCAGCGGTAGAGCACCGCCTTGCCAAGGCGGGGGTCGCGAGTTCGAATC |
Downstream region at tRNA end position |
ttaatattcc |
Secondary structure (Cloverleaf model) | >WENV183081535 Gly GCC t TCCA ttaatattcc G - C C - G G - C G - C G - C A - T A - T T A T T G C T C A G A A + | | | | G C C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC C - G C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |