Sequence ID | >WENV183088940 |
Genome ID | OLJW01001194 |
Search identical group | |
Phylum/Class | [OLJW] human gut metagenome; human gut |
Species | |
Start position on genome | 8863 |
End posion on genome | 8775 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
agtaccttat |
tRNA gene sequence |
GGAGCGGTATCGAAGTGGTCATAACGGGGCTGACTCGAAATCAGTTAGGCCGAAAGGTCT |
Downstream region at tRNA end position |
aatcaaaaac |
Secondary structure (Cloverleaf model) | >WENV183088940 Ser CGA t GCCA aatcaaaaac G - C G - C A - T G - C C - G G - C G - C T A T C A C C C A G T G A A | | | | | G G A G C T G T G G G C T | | + T T C A C G G A T A G TAGGCCGAAAGGTCTC G + T C - G T - A G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |