Sequence ID | >WENV183127275 |
Genome ID | OLNZ01000064 |
Search identical group | |
Phylum/Class | [OLNZ] human gut metagenome; faeces |
Species | |
Start position on genome | 20383 |
End posion on genome | 20459 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gtcatttatT |
tRNA gene sequence |
GCTCCGGTGGTGTAGTCCGGCCAATCATTTCGGCCTTTCGAGCCGAAGACTCGGGTTCGA |
Downstream region at tRNA end position |
taaaaacttg |
Secondary structure (Cloverleaf model) | >WENV183127275 Glu TTC T ATtt taaaaacttg G - C C - G T - A C - G C - G G - C G - C T A T G G C C C A C T G A G + | | | | G C T G T G T C G G G C G | | + T T G T C A T C C A A T AGAC T - A C - G G - C G - C C - G C A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |