Sequence ID | >WENV183131754 |
Genome ID | OLOB01000011 |
Search identical group | |
Phylum/Class | [OLOB] human gut metagenome; faeces |
Species | |
Start position on genome | 161040 |
End posion on genome | 161114 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
taatagttaA |
tRNA gene sequence |
GCCTATATAGTTCAGAAGGTAGAACGATTGACTCGTAATCAATAGGTCTGGGGTTCGATT |
Downstream region at tRNA end position |
taaaaaatca |
Secondary structure (Cloverleaf model) | >WENV183131754 Thr CGT A TTtt taaaaaatca G - C C - G C - G T + G A - T T + G A - T T T T A C C C C A A G A A | | | | | G A C T T G T G G G G C G | | | | T T G G A A C T A G AGGTC A - T T - A T - A G - C A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |