Sequence ID | >WENV183132040 |
Genome ID | OLOB01000309 |
Search identical group | |
Phylum/Class | [OLOB] human gut metagenome; faeces |
Species | |
Start position on genome | 75 |
End posion on genome | 1 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aatgtgactt |
tRNA gene sequence |
GGCCCCTTGGTCAAGCGGTTAAGACACCACCCTTTCACGGTGGTAACAGGGGTTCGATTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV183132040 Glu TTC t ACCA nnnnnnnnnn G - C G + T C - G C - G C - G C - G T - A T T T T C C C C A C G A G | | | | | G G A C T G A G G G G C G | | | T T T A G A C T A A TAAC C - G C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |