Sequence ID | >WENV183137862 |
Genome ID | OLOH01000108 |
Search identical group | |
Phylum/Class | [OLOH] human gut metagenome; faeces |
Species | |
Start position on genome | 43338 |
End posion on genome | 43424 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aagcaataaT |
tRNA gene sequence |
GCCGAGATAGTCTAGCCTGGTAAGGCGCGAGACTGGAAATCTCGTGGGAGCTTTTCCCTC |
Downstream region at tRNA end position |
attagttttt |
Secondary structure (Cloverleaf model) | >WENV183137862 Ser GGA T GTtt attagttttt G - C C - G C - G G - C A - T G - C A - T T A T G A C C C A C G A A | | | | | A C T C T G C T G G G C T | | + | T T G A G G C G T A G TGGGAGCTTTTCCCTC C - G G - C A - T G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |