Sequence ID | >WENV183166940 |
Genome ID | OLOY01005024 |
Search identical group | |
Phylum/Class | [OLOY] human gut metagenome; faeces |
Species | |
Start position on genome | 778 |
End posion on genome | 871 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
actttgctct |
tRNA gene sequence |
GGAGTAGTACTCAAGAGGCCGAAGAGGCGCCCCTGCTAAGGGCGTAGGTCGTCTAAACAA |
Downstream region at tRNA end position |
agaaaaagct |
Secondary structure (Cloverleaf model) | >WENV183166940 Ser GCT t GCCA agaaaaagct G - C G - C A - T G - C T - A A - T G - C T A T C T C C C A A G A A | | | | | A G A C T C G A G G G C G | | | T T C A G A G C G A G TAGGTCGTCTAAACAACGGCGC C - G G - C C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |