| Sequence ID | >WENV183174373 |
| Genome ID | OLPE01000870 |
| Phylum/Class | [OLPE] human gut metagenome; faeces |
| Species | |
| Start position on genome | 15789 |
| End posion on genome | 15862 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
caccatactt |
| tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACTTCAGCCTTCCAAGCTGACTACGTGGGTTCGATTCC |
| Downstream region at tRNA end position |
agtgatgata |
| Secondary structure (Cloverleaf model) | >WENV183174373 Gly TCC
t TCCA agtgatgata
G - C
C - G
G - C
G - C
G - C
T - A
G - C T T
T T A C C C A
A A A + | | | | G
T C T T G G T G G G C
G | | | | T T
G G A A C
T A T CTAC
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |